consensus oligonucleotides Search Results


irdye 700  (LI-COR)
96
LI-COR irdye 700
Irdye 700, supplied by LI-COR, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/consensus+oligonucleotides/IRDye+700+Sp-1+Consensus+Oligonucleotide/10__1523_slash_jneurosci__1930___15__2016-45-14-16
Average 96 stars, based on 1 article reviews
irdye 700 - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier
double-stranded oligonucleotides containing rxr-rxr (dr1) binding consensus sequences  (Geneka Biotechnology Inc)
90
Geneka Biotechnology Inc double-stranded oligonucleotides containing rxr-rxr (dr1) binding consensus sequences
Double Stranded Oligonucleotides Containing Rxr Rxr (Dr1) Binding Consensus Sequences, supplied by Geneka Biotechnology Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/consensus+oligonucleotides/double+stranded+oligonucleotides+containing+rxr+rxr++dr1++binding+consensus+sequences/10__1074_slash_jbc__m103587200-116-2-21
Average 90 stars, based on 1 article reviews
double-stranded oligonucleotides containing rxr-rxr (dr1) binding consensus sequences - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
22-bp dna fragment oligonucleotide nf- b consensus sequence  (Promega)
90
Promega 22-bp dna fragment oligonucleotide nf- b consensus sequence
22 Bp Dna Fragment Oligonucleotide Nf B Consensus Sequence, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/consensus+oligonucleotides/22+bp+dna+fragment+oligonucleotide+nf++b+consensus+sequence/10__1074_slash_jbc__m109__023044-79-19-23
Average 90 stars, based on 1 article reviews
22-bp dna fragment oligonucleotide nf- b consensus sequence - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
sp1 consensus binding site oligonucleotide  (Geneka Biotechnology Inc)
90
Geneka Biotechnology Inc sp1 consensus binding site oligonucleotide
Sp1 Consensus Binding Site Oligonucleotide, supplied by Geneka Biotechnology Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/consensus+oligonucleotides/sp1+consensus+binding+site+oligonucleotide/10__1074_slash_jbc__m107773200-74-1-18
Average 90 stars, based on 1 article reviews
sp1 consensus binding site oligonucleotide - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
γ- 32 p-labeled nf-κb consensus oligonucleotide probe 5′-agttgaggggactttcccaggc-3′  (Promega)
90
Promega γ- 32 p-labeled nf-κb consensus oligonucleotide probe 5′-agttgaggggactttcccaggc-3′
<t>TAB-induced</t> <t>NF-κB</t> activation is attenuated by AdCu/ZnSOD and AdDNAkt. Representative images at day 5 (A) and summary data (B) show the effects of AdLacZ, AdCu/ZnSOD, or AdDNAkt on NF-κB-driven luciferase activity (photon emission) over time in TAB mice compared with sham-operated mice. NF-κB activation was measured by in vivo bioluminescent imaging using Xenogen IVIS-200. In the pseudocolored scale, areas of high photon emission are displayed as red and areas of low photon emission are displayed as blue. Data are means ± SE (n = 4/group) expressed relative to sham-operated mice. *P < 0.05 vs. sham surgery; †P < 0.05 vs. TAB-AdLacZ. DNAkt, dominant-negative form of Akt.
γ 32 P Labeled Nf κb Consensus Oligonucleotide Probe 5′ Agttgaggggactttcccaggc 3′, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/consensus+oligonucleotides/%CE%B3++32+p+labeled+nf+%CE%BAb+consensus+oligonucleotide+probe+5++agttgaggggactttcccaggc+3+/pmc02853899-105-15-20
Average 90 stars, based on 1 article reviews
γ- 32 p-labeled nf-κb consensus oligonucleotide probe 5′-agttgaggggactttcccaggc-3′ - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
consensus and mutant oligonucleotide of sm α actin sre  (Retrogen Inc)
90
Retrogen Inc consensus and mutant oligonucleotide of sm α actin sre
<t>TAB-induced</t> <t>NF-κB</t> activation is attenuated by AdCu/ZnSOD and AdDNAkt. Representative images at day 5 (A) and summary data (B) show the effects of AdLacZ, AdCu/ZnSOD, or AdDNAkt on NF-κB-driven luciferase activity (photon emission) over time in TAB mice compared with sham-operated mice. NF-κB activation was measured by in vivo bioluminescent imaging using Xenogen IVIS-200. In the pseudocolored scale, areas of high photon emission are displayed as red and areas of low photon emission are displayed as blue. Data are means ± SE (n = 4/group) expressed relative to sham-operated mice. *P < 0.05 vs. sham surgery; †P < 0.05 vs. TAB-AdLacZ. DNAkt, dominant-negative form of Akt.
Consensus And Mutant Oligonucleotide Of Sm α Actin Sre, supplied by Retrogen Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/consensus+oligonucleotides/consensus+and+mutant+oligonucleotide+of+sm+%CE%B1+actin+sre/pmc01942159-120-8-24
Average 90 stars, based on 1 article reviews
consensus and mutant oligonucleotide of sm α actin sre - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
32 p-radiolabeled consensus oligonucleotides 5'agttgaggggactttcccaggc-3  (Promega)
90
Promega 32 p-radiolabeled consensus oligonucleotides 5'agttgaggggactttcccaggc-3
<t>TAB-induced</t> <t>NF-κB</t> activation is attenuated by AdCu/ZnSOD and AdDNAkt. Representative images at day 5 (A) and summary data (B) show the effects of AdLacZ, AdCu/ZnSOD, or AdDNAkt on NF-κB-driven luciferase activity (photon emission) over time in TAB mice compared with sham-operated mice. NF-κB activation was measured by in vivo bioluminescent imaging using Xenogen IVIS-200. In the pseudocolored scale, areas of high photon emission are displayed as red and areas of low photon emission are displayed as blue. Data are means ± SE (n = 4/group) expressed relative to sham-operated mice. *P < 0.05 vs. sham surgery; †P < 0.05 vs. TAB-AdLacZ. DNAkt, dominant-negative form of Akt.
32 P Radiolabeled Consensus Oligonucleotides 5'agttgaggggactttcccaggc 3, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/consensus+oligonucleotides/32+p+radiolabeled+consensus+oligonucleotides+5+agttgaggggactttcccaggc+3/pmc03226551-74-55-64
Average 90 stars, based on 1 article reviews
32 p-radiolabeled consensus oligonucleotides 5'agttgaggggactttcccaggc-3 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
doublestranded consensus oligonucleotides sp-1  (Promega)
90
Promega doublestranded consensus oligonucleotides sp-1
<t>TAB-induced</t> <t>NF-κB</t> activation is attenuated by AdCu/ZnSOD and AdDNAkt. Representative images at day 5 (A) and summary data (B) show the effects of AdLacZ, AdCu/ZnSOD, or AdDNAkt on NF-κB-driven luciferase activity (photon emission) over time in TAB mice compared with sham-operated mice. NF-κB activation was measured by in vivo bioluminescent imaging using Xenogen IVIS-200. In the pseudocolored scale, areas of high photon emission are displayed as red and areas of low photon emission are displayed as blue. Data are means ± SE (n = 4/group) expressed relative to sham-operated mice. *P < 0.05 vs. sham surgery; †P < 0.05 vs. TAB-AdLacZ. DNAkt, dominant-negative form of Akt.
Doublestranded Consensus Oligonucleotides Sp 1, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/consensus+oligonucleotides/doublestranded+consensus+oligonucleotides+sp+1/10__1128_slash_iai__67__10__5434___5440__1999-65-3-14
Average 90 stars, based on 1 article reviews
doublestranded consensus oligonucleotides sp-1 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
nf- b consensus oligonucleotide (59-agttgaggggactttagg c-39)  (Promega)
90
Promega nf- b consensus oligonucleotide (59-agttgaggggactttagg c-39)
<t>TAB-induced</t> <t>NF-κB</t> activation is attenuated by AdCu/ZnSOD and AdDNAkt. Representative images at day 5 (A) and summary data (B) show the effects of AdLacZ, AdCu/ZnSOD, or AdDNAkt on NF-κB-driven luciferase activity (photon emission) over time in TAB mice compared with sham-operated mice. NF-κB activation was measured by in vivo bioluminescent imaging using Xenogen IVIS-200. In the pseudocolored scale, areas of high photon emission are displayed as red and areas of low photon emission are displayed as blue. Data are means ± SE (n = 4/group) expressed relative to sham-operated mice. *P < 0.05 vs. sham surgery; †P < 0.05 vs. TAB-AdLacZ. DNAkt, dominant-negative form of Akt.
Nf B Consensus Oligonucleotide (59 Agttgaggggactttagg C 39), supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/consensus+oligonucleotides/nf++b+consensus+oligonucleotide++59+agttgaggggactttagg+c+39+/10__1128_slash_iai__01287___09-93-12-18
Average 90 stars, based on 1 article reviews
nf- b consensus oligonucleotide (59-agttgaggggactttagg c-39) - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
double-stranded 32p end-labeled oligonucleotide containing the nf- b or activator protein-1 consensus binding sequence  (Promega)
90
Promega double-stranded 32p end-labeled oligonucleotide containing the nf- b or activator protein-1 consensus binding sequence
<t>TAB-induced</t> <t>NF-κB</t> activation is attenuated by AdCu/ZnSOD and AdDNAkt. Representative images at day 5 (A) and summary data (B) show the effects of AdLacZ, AdCu/ZnSOD, or AdDNAkt on NF-κB-driven luciferase activity (photon emission) over time in TAB mice compared with sham-operated mice. NF-κB activation was measured by in vivo bioluminescent imaging using Xenogen IVIS-200. In the pseudocolored scale, areas of high photon emission are displayed as red and areas of low photon emission are displayed as blue. Data are means ± SE (n = 4/group) expressed relative to sham-operated mice. *P < 0.05 vs. sham surgery; †P < 0.05 vs. TAB-AdLacZ. DNAkt, dominant-negative form of Akt.
Double Stranded 32p End Labeled Oligonucleotide Containing The Nf B Or Activator Protein 1 Consensus Binding Sequence, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/consensus+oligonucleotides/double+stranded+32p+end+labeled+oligonucleotide+containing+the+nf++b+or+activator+protein+1+consensus+binding+sequence/pm14762344-87-16-27
Average 90 stars, based on 1 article reviews
double-stranded 32p end-labeled oligonucleotide containing the nf- b or activator protein-1 consensus binding sequence - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
32p] end-labeled nf- b (from light chain) consensus oligonucleotide  (Promega)
90
Promega 32p] end-labeled nf- b (from light chain) consensus oligonucleotide
<t>TAB-induced</t> <t>NF-κB</t> activation is attenuated by AdCu/ZnSOD and AdDNAkt. Representative images at day 5 (A) and summary data (B) show the effects of AdLacZ, AdCu/ZnSOD, or AdDNAkt on NF-κB-driven luciferase activity (photon emission) over time in TAB mice compared with sham-operated mice. NF-κB activation was measured by in vivo bioluminescent imaging using Xenogen IVIS-200. In the pseudocolored scale, areas of high photon emission are displayed as red and areas of low photon emission are displayed as blue. Data are means ± SE (n = 4/group) expressed relative to sham-operated mice. *P < 0.05 vs. sham surgery; †P < 0.05 vs. TAB-AdLacZ. DNAkt, dominant-negative form of Akt.
32p] End Labeled Nf B (From Light Chain) Consensus Oligonucleotide, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/consensus+oligonucleotides/32p++end+labeled+nf++b++from+light+chain++consensus+oligonucleotide/pm11509588-51-7-14
Average 90 stars, based on 1 article reviews
32p] end-labeled nf- b (from light chain) consensus oligonucleotide - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
ap-1 extract  (Promega)
90
Promega ap-1 extract
<t>TAB-induced</t> <t>NF-κB</t> activation is attenuated by AdCu/ZnSOD and AdDNAkt. Representative images at day 5 (A) and summary data (B) show the effects of AdLacZ, AdCu/ZnSOD, or AdDNAkt on NF-κB-driven luciferase activity (photon emission) over time in TAB mice compared with sham-operated mice. NF-κB activation was measured by in vivo bioluminescent imaging using Xenogen IVIS-200. In the pseudocolored scale, areas of high photon emission are displayed as red and areas of low photon emission are displayed as blue. Data are means ± SE (n = 4/group) expressed relative to sham-operated mice. *P < 0.05 vs. sham surgery; †P < 0.05 vs. TAB-AdLacZ. DNAkt, dominant-negative form of Akt.
Ap 1 Extract, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/consensus+oligonucleotides/nf+%CE%BAb+consensus+oligonucleotide/10__1681_slash_asn__2005060650-44-17-19
Average 90 stars, based on 1 article reviews
ap-1 extract - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results


TAB-induced NF-κB activation is attenuated by AdCu/ZnSOD and AdDNAkt. Representative images at day 5 (A) and summary data (B) show the effects of AdLacZ, AdCu/ZnSOD, or AdDNAkt on NF-κB-driven luciferase activity (photon emission) over time in TAB mice compared with sham-operated mice. NF-κB activation was measured by in vivo bioluminescent imaging using Xenogen IVIS-200. In the pseudocolored scale, areas of high photon emission are displayed as red and areas of low photon emission are displayed as blue. Data are means ± SE (n = 4/group) expressed relative to sham-operated mice. *P < 0.05 vs. sham surgery; †P < 0.05 vs. TAB-AdLacZ. DNAkt, dominant-negative form of Akt.

Journal: Physiological Genomics

Article Title: Superoxide scavenging and Akt inhibition in myocardium ameliorate pressure overload-induced NF-?B activation and cardiac hypertrophy

doi: 10.1152/physiolgenomics.00202.2009

Figure Lengend Snippet: TAB-induced NF-κB activation is attenuated by AdCu/ZnSOD and AdDNAkt. Representative images at day 5 (A) and summary data (B) show the effects of AdLacZ, AdCu/ZnSOD, or AdDNAkt on NF-κB-driven luciferase activity (photon emission) over time in TAB mice compared with sham-operated mice. NF-κB activation was measured by in vivo bioluminescent imaging using Xenogen IVIS-200. In the pseudocolored scale, areas of high photon emission are displayed as red and areas of low photon emission are displayed as blue. Data are means ± SE (n = 4/group) expressed relative to sham-operated mice. *P < 0.05 vs. sham surgery; †P < 0.05 vs. TAB-AdLacZ. DNAkt, dominant-negative form of Akt.

Article Snippet: EMSA was performed with 6 μg of nuclear protein incubated with a γ- 32 P-labeled NF-κB consensus oligonucleotide probe 5′-AGTTGAGGGGACTTTCCCAGGC-3′ (Promega, Madison, WI) as described earlier ( 52 ).

Techniques: Activation Assay, Luciferase, Activity Assay, In Vivo, Imaging, Dominant Negative Mutation